C3a Receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

1/1
Price:
Size:
Number:

C3a Receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2163 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 483T/C not causing the amino acid variation.
Description
Full length Clone DNA of Mus musculus complement component 3a receptor 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + NotI(6.54kb+2.16kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

C3a Receptor cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C3a Receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Validated Images

C3a Receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

AZ3B cDNA ORF Clone, Mouse; C3AR cDNA ORF Clone, Mouse; HNFAG09 cDNA ORF Clone, Mouse

C3a Receptor Background Information

Full Name
complement component 3a receptor 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.