Caspase-14 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

Caspase-14 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
774 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse caspase 14.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb+0.77kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Caspase-14 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About Caspase-14

Entrez Gene ID

Caspase-14 cDNA ORF Clone, Mouse, untagged: Synonyms

MICE cDNA ORF Clone, Mouse; mini-ICE cDNA ORF Clone, Mouse

Caspase-14 Background Information

Caspase 14 is a member of the caspase family. Caspases are a kind of cysteine proteinase consisting of a prodomain plus large and small catalytic subunits, that play a central role in cell apoptosis. Caspase 14 possesses an unusually short prodomain and is highly expressed in embryonic tissues but absent from most of the adult tissues except for the skin, which suggests a role in ontogenesis and skin physiology. Unlike the other short prodomain caspases(caspase-3, caspase-6, and caspase-7), Caspase 14 was not processed by multiple death stimuli including activation of members of the tumor necrosis factor receptor family and expression of proapaptotic members of the bcl-2 family. Caspase 14 has been described to be processed and activated by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may take part in keratinocyte terminal differentiation, which is essential for the skin barrier.
Full Name
caspase 14, apoptosis-related cysteine peptidase
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • p53 Pathway
    p53 Pathway
References
  • Hu SM, et al. (1998) Caspase-14 is a novel developmentally regulated protease. The journal of biological chemistry. 273: 29648-53.
  • Marc Van De Craen, et al. (1998) Identification of a new caspase homologue: caspase-14. Cell death differ. 5(10): 838-46.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.