CCL25/TECK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

CCL25/TECK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
435 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 25.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CCL25/TECK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

A130072A22Rik cDNA ORF Clone, Mouse; AI852536 cDNA ORF Clone, Mouse; CKb15 cDNA ORF Clone, Mouse; Scya25 cDNA ORF Clone, Mouse; TECK cDNA ORF Clone, Mouse

CCL25/TECK Background Information

Full Name
chemokine (C-C motif) ligand 25
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait