CXCL5 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

CXCL5 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
399 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 5 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.45kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

CXCL5 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL5 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

CXCL5 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Alternative Names

AMCF-II cDNA ORF Clone, Mouse; ENA-78 cDNA ORF Clone, Mouse; GCP-2 cDNA ORF Clone, Mouse; LIX cDNA ORF Clone, Mouse; Scyb5 cDNA ORF Clone, Mouse; Scyb6 cDNA ORF Clone, Mouse

CXCL5 Background Information

CXCL5 is a small cytokine belonging to the CXC chemokine family. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL5 is produced following stimulation of cells with the inflammatory cytokines interleukin-1 or tumor necrosis factor-alpha. It also can be detected in eosinophils, and can be inhibited with the type II interferon. CXCL5 plays a role in reducing sensitivity to sunburn pain in some subjects, and is a potential target which can be utilized to understand more about pain in other inflammatory conditions like arthritis and cystitis. It stimulates the chemotaxis of neutrophils possesses angiogenic properties. It elicits these effects by interacting with the cell surface chemokine receptor CXCR2.
Full Name
chemokine (C-X-C motif) ligand 5
References
  • Dawes JM, et al. (2011) CXCL5 Mediates UVB Irradiation-Induced Pain. Sci Transl Med. 3(90): 90ra60.
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Persson T, et al. (2003) Expression of the neutrophil-activating CXC chemokine ENA-78/CXCL5 by human eosinophils. Clin Exp Allergy. 33(4):531-7.

CXCL5 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait