FAM19A4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

FAM19A4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
408 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus family with sequence similarity 19, member A4.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

FAM19A4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

C130034I18Rik cDNA ORF Clone, Mouse; Fam19a4Tafa-4 cDNA ORF Clone, Mouse; Tafa-4 cDNA ORF Clone, Mouse

FAM19A4 Background Information

Full Name
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait