Fas/CD95 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

1/1
Price:
Size:
Number:

Fas/CD95 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1713 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 234C/T,330G/A,456G/A not causing the amino acid variation.
Description
Full length Clone DNA of Mus musculus Fas (TNF receptor superfamily member 6).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI(two restriction sites) + NotI(6.54kb+0.82kb+0.90kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Fas/CD95 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fas/CD95 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Validated Images

Fas/CD95 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

AI196731 cDNA ORF Clone, Mouse; APO1 cDNA ORF Clone, Mouse; APT1 cDNA ORF Clone, Mouse; CD95 cDNA ORF Clone, Mouse; lpr cDNA ORF Clone, Mouse; TNFR6 cDNA ORF Clone, Mouse; Tnfrsf6 cDNA ORF Clone, Mouse

Fas/CD95 Background Information

CD95 (APO-1/Fas) is an important inducer of the extrinsic apoptosis signaling pathway and therapy induced apoptosis of many tumor cells has been linked to the activity of CD95. is a prototype death receptor characterized by the presence of an 8 amino acid death domain in its cytoplasmic tail. This domain is essential for the recruitment of a number of signaling components upon activation by either agonistic anti-CD95 antibodies or cognate CD95 ligand that initiate apoptosis. The complex of proteins that forms upon triggering of CD95 is called the death-inducting signaling complex (DISC). The DISC consists of an adaptor protein and initiator caspases and is essential for induction of apoptosis. CD95 is also crucial for the negative selection of B cells within the germinal center (GC). Impairment of CD95-mediated apoptosis results in defective affinity maturation and the persistence of autoreactive B-cell clones. Changes in the expression of CD95 and/or its ligand CD95L are frequently found in human cancer. The downregulation or mutation of CD95 has been proposed as a mechanism by which cancer cells avoid destruction by the immune system through reduced apoptosis sensitivity. Thus, CD95 has therefore been viewed as a tumor suppressor. CD95 has been reported to be involved in the activation of NF-kappaB, MAPK3/ERK1, MAPK8/JNK, and the alternate pathways for CTL-mediated cytotoxicity. Accordingly, this protein is implicated in the pathogenesis of various malignancies and diseases of the immune system. The CD95/CD95L system was implicated in the etiology of inflammatory bowel disease (IBD) based, primarily, on the finding that CD95 is highly expressed in the intestinal epithelial cells and that epithelial apoptosis is increased in IBD.
Full Name
Fas cell surface death receptor
Research Areas
Related Pathways
  • Death Receptor Signaling
    Death Receptor Signaling
  • p53 Pathway
    p53 Pathway
  • AMPK Signaling Pathway
    AMPK Signaling Pathway
References
  • Mschen M, et al. (2002) The origin of CD95-gene mutations in B-cell lymphoma. Trends Immunol. 23(2): 75-80.
  • Peter ME, et al. (2003) The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ. 10(1): 26-35.
  • Peter ME, et al. (2005) Does CD95 have tumor promoting activities Biochim Biophys Acta. 1755(1): 25-36.
  • Chen L, et al. (2010) Cell death in the colonic epithelium during inflammatory bowel diseases: CD95/Fas and beyond. Inflamm Bowel Dis. 16(6): 1071-6.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.