HMGB1 cDNA ORF Clone, Mouse, C-His tag

Price:
Size:
Number:

HMGB1 cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Mouse high mobility group box 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HMGB1 cDNA ORF Clone, Mouse, C-His tag: Synonyms

amphoterin cDNA ORF Clone, Mouse; DEF cDNA ORF Clone, Mouse; HMG-1 cDNA ORF Clone, Mouse; Hmg1 cDNA ORF Clone, Mouse; p30 cDNA ORF Clone, Mouse; SBP-1 cDNA ORF Clone, Mouse

HMGB1 Background Information

High-mobility group box 1 protein (HMGB1), also known as HMG-1 or amphoterin previously, is a member of the HMGB family consisting of three members, HMGB1, HMGB2, and HMGB3. HMGB1 is a DNA-binding nuclear protein, released actively following cytokine stimulation as well as passively during cell death. It is the prototypic damage-associated molecular pattern (DAMP) molecule and has been implicated in several inflammatory disorders. HMGB1 signals via the receptor for advanced glycation end-product (RAGE) and members of the toll-like receptor (TLR) family. The most prominent HMGB1 protein and mRNA expression arthritis are present in pannus regions, where synovial tissue invades articular cartilage and bone. HMGB1 promotes the activity of proteolytic enzymes, and osteoclasts need HMGB1 for functional maturation. As a non-histone nuclear protein, HMGB1 has a dual function. Inside the cell, HMGB1 binds DNA, regulating transcription, and determining chromosomal architecture. Outside the cell, HMGB1 can serve as an alarmin to activate the innate system and mediate a wide range of physiological and pathological responses. Extracellular HMGB1 represents an optimal " necrotic marker" selected by the innate immune system to recognize tissue damage and initiate reparative responses. However, extracellular HMGB1 also acts as a potent pro-inflammatory cytokine that contributes to the pathogenesis of diverse inflammatory and infectious disorders. HMGB1 has been successfully therapeutically targeted in multiple preclinical models of infectious and sterile diseases including arthritis. As shown in studies on patients as well as animal models, HMGB1 can play an important role in the pathogenesis of the rheumatic disease, including rheumatoid arthritis, systemic lupus erythematosus, and polymyositis among others. Besides, enhanced postmyocardial infarction remodeling in type 1 diabetes mellitus was partially mediated by HMGB1 activation.
Full Name
high mobility group box 1
Related Pathways
  • Autophagy Pathway
    Autophagy Pathway
References
  • Ulloa L, et al. (2006) High-mobility group box 1 (HMGB1) protein: friend and foe. Cytokine Growth Factor Rev. 17 (3): 189-201.
  • Pisetsky DS, et al. (2008) High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease. Arthritis Res Ther. 10 (3): 209.
  • Volz HC, et al. (2010) The role of HMGB1/RAGE in inflammatory cardiomyopathy. Semin Thromb Hemost. 36(2): 185-94.
  • Sims GP, et al. (2010) HMGB1 and RAGE in inflammation and cancer. Annu Rev Immunol. 28: 367-88.
  • Andersson U, et al. (2010) The role of HMGB1 in the pathogenesis of rheumatic disease. Biochim Biophys Acta. 1799 (1-2): 141-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.