IGFBP7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

1/1
Price:
Size:
Number:

IGFBP7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1578 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mus musculus insulin-like growth factor binding protein 7.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + NotI(two restriction sites)(6.54kb+0.01kb+1.58kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

IGFBP7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGFBP7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Validated Images

IGFBP7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

AGM cDNA ORF Clone, Mouse; Fstl2 cDNA ORF Clone, Mouse; Mac25 cDNA ORF Clone, Mouse

IGFBP7 Background Information

Insulin-like growth factor-binding protein 7 (IGFBP7) is a member of the IGFBP family. It has been identified in colorectal adenocarcinoma (CRC) cell lines. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF or act in an IGF-independent manner in the prostate. IGFBP7 could inhibit cell growth, decrease soft agar colony formation activity, and induce apoptosis in RKO and SW620 cells. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence, and IGF affinity.
Full Name
insulin-like growth factor binding protein 7
References
  • Oh Y, et al. (1996) Synthesis and characterization of insulin-like growth factor-binding protein (IGFBP)-7. Recombinant human mac25 protein specifically binds IGF-I and -II. J Biol Chem. 271(48): 30322-5.
  • Wilson EM, et al. (1997) Generation and characterization of an IGFBP-7 antibody: identification of 31kD IGFBP-7 in human biological fluids and Hs578T human breast cancer conditioned media. J Clin Endocrinol Metab. 82(4): 1301-3.
  • Lin J, et al. (2007) Methylation patterns of IGFBP7 in colon cancer cell lines are associated with levels of gene expression. J Pathol. 212(1): 83-90.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.