IP-10/CXCL10 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

IP-10/CXCL10 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
297 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 10 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.35kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

IP-10/CXCL10 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IP-10/CXCL10 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

IP-10/CXCL10 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Synonyms

C7 cDNA ORF Clone, Mouse; CRG-2 cDNA ORF Clone, Mouse; gIP-10 cDNA ORF Clone, Mouse; Ifi10 cDNA ORF Clone, Mouse; INP10 cDNA ORF Clone, Mouse; IP-10 cDNA ORF Clone, Mouse; IP10 cDNA ORF Clone, Mouse; mob-1 cDNA ORF Clone, Mouse; Scyb10 cDNA ORF Clone, Mouse

IP-10/CXCL10 Background Information

(C-X-C motif) ligand (CXCL)10 (CXCL10) belongs to the ELR(-) CXC subfamily chemokine. CXCL10/IP-10 exerts its function through binding to chemokine (C-X-C motif) receptor 3 (CXCR3), a seven trans-membrane receptor coupled to G proteins. CXCL10/IP-10 and its receptor, CXCR3, appear to contribute to the pathogenesis of many autoimmune diseases, organ specific (such as type 1 diabetes, autoimmune thyroiditis, Graves' disease and ophthalmopathy), or systemic (such as rheumatoid arthritis, psoriatic arthritis, systemic lupus erythematosus, mixed cryoglobulinemia, Sjögren syndrome, or systemic sclerosis). CXCL10/IP-10 is secreted by several cell types including endothelial cells, fibroblasts, keratinocytes, thyrocytes, preadipocytes, etc. Determination of high level of CXCL10/IP-10 in peripheral fluids is therefore a marker of host immune response.
Full Name
chemokine (C-X-C motif) ligand 10
Research Areas
Related Pathways
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Swaminathan GJ, et al. (2003) Crystal structures of oligomeric forms of the IP-10/CXCL10 chemokine. Structure. 11(5):521-32.
  • Booth V, et al. (2002) The CXCR3 binding chemokine IP-10/CXCL10: structure and receptor interactions. Biochemistry. 41(33):10418-25.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.