MCP-1/CCL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag

1/2
Price:
Size:
Number:

MCP-1/CCL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
447 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse chemokine (C-C motif) ligand 2 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.18kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MCP-1/CCL2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MCP-1/CCL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

MCP-1/CCL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

AI323594 cDNA ORF Clone, Mouse; HC11 cDNA ORF Clone, Mouse; JE cDNA ORF Clone, Mouse; MCAF cDNA ORF Clone, Mouse; MCP-1 cDNA ORF Clone, Mouse; MCP1 cDNA ORF Clone, Mouse; Scya2 cDNA ORF Clone, Mouse; Sigje cDNA ORF Clone, Mouse; SMC-CF cDNA ORF Clone, Mouse

MCP-1/CCL2 Background Information

Monocyte chemoattractant protein 1 (MCP-1), also called CCL2, belongs to a group of CC chemokines located in chromosome 17q11.2. MCP-1 protein interacts with chemokine C-C motif receptor 2 (CCR2) to activate and recruit monocytes, macrophages, CD4+ T cells and immature dendritic cells to the site of infection [7–9]. The presence of MCP-1 protein in an adequate concentration is important for granuloma formation and M. tuberculosis clearance.
Full Name
chemokine (C-C motif) ligand 2
Research Areas
Related Pathways
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Vásquez-Loarte T, Trubnykova M, Guio H. Genetic association meta-analysis: a new classification to assess ethnicity using the association of MCP-1 -2518 polymorphism and tuberculosis susceptibility as a model. BMC Genetics. 2015;16:128.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.