MCP-1/CCL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

MCP-1/CCL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
447 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

MCP-1/CCL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

AI323594 cDNA ORF Clone, Mouse; HC11 cDNA ORF Clone, Mouse; JE cDNA ORF Clone, Mouse; MCAF cDNA ORF Clone, Mouse; MCP-1 cDNA ORF Clone, Mouse; MCP1 cDNA ORF Clone, Mouse; Scya2 cDNA ORF Clone, Mouse; Sigje cDNA ORF Clone, Mouse; SMC-CF cDNA ORF Clone, Mouse

MCP-1/CCL2 Background Information

Monocyte chemoattractant protein 1 (MCP-1), also called CCL2, belongs to a group of CC chemokines located in chromosome 17q11.2. MCP-1 protein interacts with chemokine C-C motif receptor 2 (CCR2) to activate and recruit monocytes, macrophages, CD4+ T cells and immature dendritic cells to the site of infection [7–9]. The presence of MCP-1 protein in an adequate concentration is important for granuloma formation and M. tuberculosis clearance.
Full Name
chemokine (C-C motif) ligand 2
Research Areas
Related Pathways
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Vásquez-Loarte T, Trubnykova M, Guio H. Genetic association meta-analysis: a new classification to assess ethnicity using the association of MCP-1 -2518 polymorphism and tuberculosis susceptibility as a model. BMC Genetics. 2015;16:128.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.