Myelin Oligodendrocyte Glycoprotein cDNA ORF Clone, Mouse, untagged

1/1
Price:
Size:
Number:

Myelin Oligodendrocyte Glycoprotein cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
744 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse myelin oligodendrocyte glycoprotein.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 0.74kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Myelin Oligodendrocyte Glycoprotein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Myelin Oligodendrocyte Glycoprotein cDNA ORF Clone, Mouse, untagged: Validated Images

Myelin Oligodendrocyte Glycoprotein cDNA ORF Clone, Mouse, untagged: Synonyms

B230317G11Rik cDNA ORF Clone, Mouse

Myelin Oligodendrocyte Glycoprotein Background Information

Myelin oligodendrocyte glycoprotein (MOG) is a transmembrane protein belonging to the immunoglobulin superfamily and contains an Ig-like domain followed by two potential membrane-spanning regions. MOG is expressed only in the CNS with very low content (approximately 0.1% total proteins) in the oligodendrogliocyte membrane. Three possible functions for MOG were suggested: (a) a cellular adhesive molecule, (b) a regulator of oligodendrocyte microtubule stability, and (c) a mediator of interactions between myelin and the immune system, in particular, the complement cascade. A direct interaction might exist between the membrane-associated regions of MOG and the myelin-specific glycolipid galactocerebroside (Gal-C), and such an interaction may have important consequences regarding the membrane topology and function of both molecules. It is considered that MOG is an autoantigen capable to produce demyelinating multiple sclerosis-like diseases in experimental animals.
Full Name
myelin oligodendrocyte glycoprotein
References
  • Chekhonin VP, et al. (2003) Myelin oligodendrogliocyte glycoprotein: the structure, functions, role in pathogenesis of demyelinating disorders. Biomed Khim. 49(5): 411-23.
  • Hilton AA, et al. (1995) Characterization of cDNA and Genomic Clones Encoding Human Myelin Oligodendrocyte Glycoprotein. J Neurochem. 65(1): 309-18.
  • Johns TG, et al. (1999) The Structure and Function of Myelin Oligodendrocyte Glycoprotein. J Neurochem. 72(1): 1-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.