NNT1 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

NNT1 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
678 bp
Description
Full length Clone DNA of Mouse cardiotrophin-like cytokine factor 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

NNT1 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Alternative Names

Bsf3 cDNA ORF Clone, Mouse; CLC cDNA ORF Clone, Mouse

NNT1 Background Information

Full Name
cardiotrophin-like cytokine factor 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait