PCTAIRE1 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

PCTAIRE1 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1491 bp
Description
Full length Clone DNA of Mouse cyclin-dependent kinase 16.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PCTAIRE1 cDNA ORF Clone, Mouse, untagged: Synonyms

Crk5 cDNA ORF Clone, Mouse; Pctaire1 cDNA ORF Clone, Mouse; Pctk1 cDNA ORF Clone, Mouse

PCTAIRE1 Background Information

Full Name
cyclin-dependent kinase 16
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.