Protein S/PROS1 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

Protein S/PROS1 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2028 bp
Description
Full length Clone DNA of Mouse protein S (alpha) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About Protein S/PROS1

Entrez Gene ID

Protein S/PROS1 cDNA ORF Clone, Mouse, N-Myc tag: Synonyms

AW214361 cDNA ORF Clone, Mouse

Protein S/PROS1 Background Information

PROS1, also known as protein S, is a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. PROS1 has two isoforms: a free, functionally active form and an inactive form complexed with C4b-binding protein. Besides its anticoagulant function, PROS1 also acts as an agonist for the tyrosine kinase receptors Tyro3, Axl, and Mer. The endothelium expresses Tyro3, Axl, and Mer and produces protein S. The interaction of protein S with endothelial cells and particularly its effects on angiogenesis have not yet been analyzed.
Full Name
protein S (alpha)
References
  • Beauchamp NJ. et al., 2004, Br J Haematol. 125 (5): 647-54.
  • García de Frutos P. et al., 2007, Thromb Haemost. 98 (3): 543-56.
  • Rezende SM. et al., 2004, Blood. 103 (4): 1192-201.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.