Src cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

Src cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1608 bp
Description
Full length Clone DNA of Mouse Rous sarcoma oncogene, transcript variant 2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Src cDNA ORF Clone, Mouse, untagged: Synonyms

AW259666 cDNA ORF Clone, Mouse; pp60c-src cDNA ORF Clone, Mouse

Src Background Information

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.
Full Name
SRC proto-oncogene, non-receptor tyrosine kinase
Research Areas
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
References
  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.

Src cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.