STAT6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

STAT6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2514 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus signal transducer and activator of transcription 6.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

STAT6 Background Information

Signal transducer and activator of transcription 6 (STAT6) is a transcription factor that is activated by interleukin-4 (IL-4)-induced tyrosine phosphorylation and mediates most of the IL-4-induced gene expression. STAT6 plays a central role in exerting interleukin-4 (IL-4) mediated biological responses and is found to induce the expression of BCL2L1/BCL-XL, which is responsible for the anti-apoptotic activity of IL4. Transcriptional activation by STAT6 requires the interaction with coactivators like p3 and the CREB-binding protein (CBP). NF-?B and tyrosine-phosphorylated Stat6 can directly bind each other in vitro and in vivo, which suggest that the direct interaction between Stat6 and NF-?B may provide a basis for synergistic activation of transcription by IL-4 and activators of NF-?B.
Full Name
signal transducer and activator of transcription 6, interleukin-4 induced
Related Pathways
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
References
  • Litterst CM, et al. (2001) Transcriptional activation by STAT6 requires the direct interaction with NCoA-1. J Biol Chem. 276 (49): 45713-21.
  • Stutz AM, et al. (1999) Functional synergism of STAT6 with either NF-kappa B or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription. J Immunol. 163 (8): 4383-91.
  • Yang J, et al. (2002) Identification of p100 as a coactivator for STAT6 that bridges STAT6 with RNA polymerase II. EMBO J. 21 (18): 4950-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.