Syndecan-1/CD138 cDNA ORF Clone, Mouse, C-HA tag

1/1
Price:
Size:
Number:

Syndecan-1/CD138 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
978 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse syndecan 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.98kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Syndecan-1/CD138 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Syndecan-1/CD138 cDNA ORF Clone, Mouse, C-HA tag: Validated Images

Syndecan-1/CD138 cDNA ORF Clone, Mouse, C-HA tag: Synonyms

AA408134 cDNA ORF Clone, Mouse; AA409076 cDNA ORF Clone, Mouse; CD138 cDNA ORF Clone, Mouse; Sstn cDNA ORF Clone, Mouse; syn-1 cDNA ORF Clone, Mouse; Synd cDNA ORF Clone, Mouse; Synd1 cDNA ORF Clone, Mouse

Syndecan-1/CD138 Background Information

Syndecan-1 also known as SDC1 and CD138, is the most extensively studied member of the syndecan family. It is found mainly in epithelial cells, but its expression is developmentally regulated during embryonic development. Syndecan-1/SDC1/CD138 has been shown to mediate cell adhesion to several ECM molecules, and to act as a coreceptor for fibroblast growth factors, potent angiogenic growth factors involved also in differentiation. Syndecan-1/SDC1/CD138 expression is reduced during malignant transformation of various epithelia, and this loss correlates with the histological differentiation grade of squamous cell carcinomas, lacking from poorly differentiated tumours. In squamous cell carcinomas of the head and neck, positive syndecan-1 expression correlates with a more favourable prognosis. Experimental studies on the role of Syndecan-1 in malignant transformation have shown that Syndecan-1/SDC1/CD138 expression is associated with the maintenance of epithelial morphology, anchorage-dependent growth and inhibition of invasiveness in vitro.
Full Name
syndecan 1
References
  • Inki P, et al. (1996) The role of syndecan-1 in malignancies. Ann Med. 28(1): 63-7.
  • Subramanian SV, et al. (1997) Regulated shedding of syndecan-1 and -4 ectodomains by thrombin and growth factor receptor activation. J Biol Chem. 272(23): 14713-20.
  • Park PW, et al. (2001) Exploitation of syndecan-1 shedding by Pseudomonas aeruginosa enhances virulence. Nature. 411(6833): 98-102.

Syndecan-1/CD138 cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.