CPN1 cDNA ORF Clone, Rat, untagged

Price:
Size:
Number:

CPN1 cDNA ORF Clone, Rat, untagged: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1374 bp
Description
Full length Clone DNA of Rat carboxypeptidase N, polypeptide 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CPN1 Background Information

Full Name
carboxypeptidase N, polypeptide 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.