IL10RA cDNA ORF Clone, Rat, untagged

Price:
Size:
Number:

IL10RA cDNA ORF Clone, Rat, untagged: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1710 bp
Description
Full length Clone DNA of Rat interleukin 10 receptor, alpha.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL10RA Background Information

CD210, also known as IL1RA, is a receptor for interleukin 1. CD210 has been shown to mediate the immunosuppressive signal of interleukin 1, and thus inhibits the synthesis of proinflammatory cytokines. It is structurally related to IFN receptors. It has been reported that CD210 promotes survival of progenitor myeloid cells. Activation of CD210 leads to tyrosine phosphorylation of JAK1 and TYK2 kinases.
Full Name
interleukin 10 receptor, alpha
References
  • Josephson K, et al. (2001) Purification, crystallization and preliminary X-ray diffraction of a complex between IL-10 and soluble IL-10R1. Acta Crystallogr D Biol Crystallogr. 57(Pt 12): 1908-11.
  • Tan, J C, et al. (1995) Characterization of recombinant extracellular domain of human interleukin-10 receptor. J Biol Chem. 270(21):12906-11.
  • Josephson, K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15(1):35-46.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait