MCP-1/CCL2 cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

MCP-1/CCL2 cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
447 bp
Description
Full length Clone DNA of Rat chemokine (C-C motif) ligand 2 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MCP-1/CCL2 Background Information

Monocyte chemoattractant protein 1 (MCP-1), also called CCL2, belongs to a group of CC chemokines located in chromosome 17q11.2. MCP-1 protein interacts with chemokine C-C motif receptor 2 (CCR2) to activate and recruit monocytes, macrophages, CD4+ T cells and immature dendritic cells to the site of infection [7–9]. The presence of MCP-1 protein in an adequate concentration is important for granuloma formation and M. tuberculosis clearance.
Full Name
chemokine (C-C motif) ligand 2
Research Areas
Related Pathways
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Vásquez-Loarte T, Trubnykova M, Guio H. Genetic association meta-analysis: a new classification to assess ethnicity using the association of MCP-1 -2518 polymorphism and tuberculosis susceptibility as a model. BMC Genetics. 2015;16:128.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.