Sino Biological - 공식 웹사이트

RELT/TNFRSF19L Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

RELT/TNFRSF19L Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1284 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus RELT tumor necrosis factor receptor.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

RELT/TNFRSF19L Background Information

Receptor expressed in lymphoid tissues (RELT), also known as tumor necrosis factor receptor superfamily, member 19-like (TNFRSF19L), is a member of the TNF-receptor superfamily. This receptor is especially abundant in hematologic tissues. It has been shown to activate the NF-kappaB pathway and selectively bind TNF receptor-associated factor 1. RELT/TNFRSF19L is capable of stimulating T-cell proliferation in the presence of CD3 signaling, which suggests its regulatory role in immune response. RELT/TNFRSF19L is a type I transmembrane glycoprotein with a cysteine-rich extracellular domain, possessing significant homology to other members of the TNFR superfamily, especially TNFRSF19, DR3, OX4, and LTbeta receptor. RELT/TNFRSF19L is able to activate the NF-kappaB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. RELT/TNFRSF19L is able to activate the NF-κB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. Although the soluble form of RELT fusion protein does not inhibit the one-way mixed lymphocyte reaction, immobilized RELT/TNFRSF19L is capable of costimulating T-cell proliferation in the presence of CD3 signaling.
Full Name
RELT tumor necrosis factor receptor
References
  • Sica GL, et al. (2001) RELT, a new member of the tumor necrosis factor receptor superfamily, is selectively expressed in hematopoietic tissues and activates transcription factor NF-kappaB. Blood. 97(9): 2702-7.
  • Polek TC, et al. (2006) The TNF receptor, RELT, binds SPAK and uses it to mediate p38 and JNK activation. Biochem Biophys Res Commun. 343(1): 125-34.
  • Cusick JK, et al. (2006) Identification of RELT homologues that associate with RELT and are phosphorylated by OSR1. Biochem Biophys Res Commun. 340(2): 535-43.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait