CDK7 cDNA ORF Clone, Rhesus, untagged

Price:
Size:
Number:

CDK7 cDNA ORF Clone, Rhesus, untagged: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Rhesus cyclin-dependent kinase 7.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CDK7 Background Information

Full Name
cyclin-dependent kinase 7
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.