SARS coronavirus (SARS-CoV) (strain WH20) 3CLpro Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag

Price:
Size:
Number:

SARS coronavirus (SARS-CoV) (strain WH20) 3CLpro Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag: General Information

Gene
Species
SARS
RefSeq ORF Size
918 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of SARS coronavirus (SARS-CoV) (strain WH20) 3CLpro.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CoV 3CLpro / 3C-like protease Background Information

3C-like protease (3CLpro) is the main protease of Humann Coronavirus. 3C-like protease (3CLpro) is a key enzyme, as it cleaves several sites to produce non-structural proteins that are essential for genome replication and Coronavirus virion production, such as an RNA-dependent RNA polymerase, a helicase, ribonucleases and 3CLpro itself, from two types of polyproteins (pp1a and pp1ab). SARS-CoV 3CLpro exists as a homodimer and each protomer has an active site.
References
  • Tomonari Muramatsu,et al.Autoprocessing mechanism of severe acute respiratory syndrome coronavirus 3C-like protease (SARS-CoV 3CLpro) from its polyproteins.FEBS Journal.2013
  • Ziebuhr J,Molecular biology of severe acute respiratory syndrome coronavirus. Curr Opin Microbiol.2004
  • Yang H, et al. The crystal structures of severe acute respiratory syndrome virus main protease and its complex with an inhibitor. Proc Natl Acad Sci USA.2003

CoV 3CLpro / 3C-like protease cDNA ORF Clone, SARS, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.