SARS coronavirus (SARS-CoV) (strain WH20) 3CLpro Gene ORF cDNA clone expression plasmid, C-HA tag

Price:
Size:
Number:

SARS coronavirus (SARS-CoV) (strain WH20) 3CLpro Gene ORF cDNA clone expression plasmid, C-HA tag: General Information

Gene
Species
SARS
RefSeq ORF Size
918 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of SARS coronavirus (SARS-CoV) (strain WH20) 3CLpro with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CoV 3CLpro / 3C-like protease Background Information

3C-like protease (3CLpro) is the main protease of Humann Coronavirus. 3C-like protease (3CLpro) is a key enzyme, as it cleaves several sites to produce non-structural proteins that are essential for genome replication and Coronavirus virion production, such as an RNA-dependent RNA polymerase, a helicase, ribonucleases and 3CLpro itself, from two types of polyproteins (pp1a and pp1ab). SARS-CoV 3CLpro exists as a homodimer and each protomer has an active site.
References
  • Tomonari Muramatsu,et al.Autoprocessing mechanism of severe acute respiratory syndrome coronavirus 3C-like protease (SARS-CoV 3CLpro) from its polyproteins.FEBS Journal.2013
  • Ziebuhr J,Molecular biology of severe acute respiratory syndrome coronavirus. Curr Opin Microbiol.2004
  • Yang H, et al. The crystal structures of severe acute respiratory syndrome virus main protease and its complex with an inhibitor. Proc Natl Acad Sci USA.2003

CoV 3CLpro / 3C-like protease cDNA ORF Clone, SARS, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.