Zika virus (ZIKV)(ZikaSPH2015) Capsid protein / Zika-C Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag

Price:
Size:
Number:

Zika virus (ZIKV)(ZikaSPH2015) Capsid protein / Zika-C Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag: General Information

Gene
Species
ZIKV
NCBI Ref Seq
RefSeq ORF Size
378 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Zika virus(ZIKV)(ZikaSPH2015) C.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

ZIKV Capsid protein Background Information

Zika virus capsid protein is a structural protein of Zika virus particle. The function of capsid protein is RNA binding to form the nucleocapsid.
References
  • Marina Basarab specialty registrar. et al .Zika virus. BMJ 2016; 352:i1049 doi: 10.1136/bmj.i1049
  • Pinto Júnior VL, et al. Zika virus: a review to clinicians, Acta Med Port 2015 Nov-Dec;28(6):760-765
  • Wong SS-Y, et al., Zika virus infectiondthe next wave after dengue?, Journal of the Formosan Medical Association (2016)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.