cIAP2/BIRC3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

cIAP2/BIRC3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1809 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus baculoviral IAP repeat-containing 3
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

More Information About cIAP2/BIRC3

Entrez Gene ID

cIAP2/BIRC3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

Api1 cDNA ORF Clone, Mouse; Api2 cDNA ORF Clone, Mouse; AW107670 cDNA ORF Clone, Mouse; Birc2 cDNA ORF Clone, Mouse; cIAP-1 cDNA ORF Clone, Mouse; cIAP-2 cDNA ORF Clone, Mouse; cIAP1 cDNA ORF Clone, Mouse; cIAP2 cDNA ORF Clone, Mouse; HIAP2 cDNA ORF Clone, Mouse; IAP1 cDNA ORF Clone, Mouse; IAP2 cDNA ORF Clone, Mouse; MIAP1 cDNA ORF Clone, Mouse; MIAP2 cDNA ORF Clone, Mouse; MIHB cDNA ORF Clone, Mouse; MIHC cDNA ORF Clone, Mouse; RNF49 cDNA ORF Clone, Mouse
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait