ENPP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

ENPP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2817 bp
Sequence Description
The translated amino acid sequence is identical with NP_006199.2.
Description
Full length Clone DNA of Human ectonucleotide pyrophosphatase/phosphodiesterase 1
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+2.82kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ENPP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About ENPP1

Entrez Gene ID

ENPP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

ENPP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

ARHR2 cDNA ORF Clone, Human; COLED cDNA ORF Clone, Human; M6S1 cDNA ORF Clone, Human; NPP1 cDNA ORF Clone, Human; NPPS cDNA ORF Clone, Human; PC-1 cDNA ORF Clone, Human; PCA1 cDNA ORF Clone, Human; PDNP1 cDNA ORF Clone, Human; TBR2 cDNA ORF Clone, Human

ENPP1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait