CCR4/CD194 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

CCR4/CD194 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1083 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C-C motif) receptor 4.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 1.08kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCR4/CD194 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCR4/CD194 cDNA ORF Clone, Human, untagged: Validated Images

CCR4/CD194 cDNA ORF Clone, Human, untagged: Alternative Names

CC-CKR-4 cDNA ORF Clone, Human; CD194 cDNA ORF Clone, Human; ChemR13 cDNA ORF Clone, Human; CKR4 cDNA ORF Clone, Human; CMKBR4 cDNA ORF Clone, Human; HGCN:14099 cDNA ORF Clone, Human; K5-5 cDNA ORF Clone, Human

CCR4/CD194 Background Information

CCR4 is a chemokine receptor that has a critical role in immune cell trafficking. T-helper type 2 cells (Th2), regulatory T cells (Treg), interluekin-17–producing T-helper cells (Th17), and skin-homing memory T cells express CCR4 on their surface and migrate toward the chemokines CCL17 and CCL22. CCR4, a C-C type chemokine receptor, has previously been focused on its biological function in immunopathogenesis of hematological tumors. To date, relatively little attention has been paid to the role of CCR4 in promoting metastasis of some solid tumors, including gastric cancer. Our group has shown that the lymphocyte-rich gastric cancers tend to be more frequently positive for CCR4, and found a novel role of CCR4 in tumor-induced immunosuppression, indicating various expression profiles of CCR4 in gastric cancer tissues and multifunctional roles of this molecule in gastric cancer progression.
Full Name
chemokine (C-C motif) receptor 4
References
  • Yang Y, Du L, Yang X, et al. Aberrant CCR4 Expression Is Involved in Tumor Invasion of Lymph Node-Negative Human Gastric Cancer. Tang C-H, ed. PLoS ONE. 2015;10(3):e0120059. doi:10.1371/journal.pone.0120059.
  • Nakagawa M, Schmitz R, Xiao W, et al. Gain-of-function CCR4 mutations in adult T cell leukemia/lymphoma. The Journal of Experimental Medicine. 2014;211(13):2497-2505.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait