CDC40 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

CDC40 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1740 bp
Description
Full length Clone DNA of Human cell division cycle 40 homolog with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CDC40 cDNA ORF Clone, Human, C-HA tag: Alternative Names

EHB3 cDNA ORF Clone, Human; PRP17 cDNA ORF Clone, Human; PRPF17 cDNA ORF Clone, Human

CDC40 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait