RSK3 cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

RSK3 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2931 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 108C/T,2148A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human ribosomal protein S6 kinase, 90kDa, polypeptide 2 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+2.93kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RSK3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RSK3 cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

RSK3 cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

HU-2 cDNA ORF Clone, Human; MAPKAPK1C cDNA ORF Clone, Human; p90-RSK3 cDNA ORF Clone, Human; pp90RSK3 cDNA ORF Clone, Human; RSK cDNA ORF Clone, Human; RSK3 cDNA ORF Clone, Human; S6K-alpha cDNA ORF Clone, Human; S6K-alpha2 cDNA ORF Clone, Human

RSK3 Background Information

Ribosomal protein S6 kinase alpha-2, also known as 9 kDa ribosomal protein S6 kinase 2, MAP kinase-activated protein kinase 1c, MAPK-activated protein kinase 1c, Ribosomal S6 kinase 3, RSK-3, RPS6KA2 and MAPKAPK1C, is a nucleus protein which belongs to theprotein kinase superfamily, AGC Ser/Thr protein kinase family and S6 kinase subfamily. RPS6KA2 / RSK-3 is expressed in many tissues. Highest expression is in lung and skeletal muscle. The expression of RPS6KA2 reduced proliferation, caused G1 arrest, increased apoptosis, reduced levels of phosphorylated extracellular signal-regulated kinase and altered other cell cycle proteins. RPS6KA2 / RSK-3 contains oneAGC-kinase C-terminal domain and twoprotein kinase domains. It forms a complex with either ERK1 or ERK2 in quiescent cells. It transiently dissociates following mitogenic stimulation. RPS6KA2 / RSK-3 is a serine/threonine kinase that may play a role in mediating the growth-factor and stress induced activation of the transcription factor CREB. RPS6KA1, RPS6KA2, RPS6KB1, RPS6KB2, and PDK1 are involved in several pathways central to the carcinogenic process, including regulation of cell growth, insulin, and inflammation.
Full Name
ribosomal protein S6 kinase, 90kDa, polypeptide 2
References
  • Zhao Y., et al.,(1995), RSK3 encodes a novel pp90rsk isoform with a unique N-terminal sequence: growth factor-stimulated kinase function and nuclear translocation. Mol. Cell. Biol. 15:4353-4363.
  • Mungall A.J., et al., (2003), The DNA sequence and analysis of human chromosome 6.Nature 425:805-811.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait