KCNK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

KCNK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human potassium channel, subfamily K, member 2
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.31kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

KCNK2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About KCNK2

Entrez Gene ID

KCNK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

KCNK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

hTREK-1c cDNA ORF Clone, Human; hTREK-1e cDNA ORF Clone, Human; K2p2.1 cDNA ORF Clone, Human; TPKC1 cDNA ORF Clone, Human; TREK cDNA ORF Clone, Human; TREK-1 cDNA ORF Clone, Human; TREK1 cDNA ORF Clone, Human

KCNK2 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait