GPIHBP1 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

GPIHBP1 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Mouse GPI-anchored HDL-binding protein 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GPIHBP1 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

1110002J19Rik cDNA ORF Clone, Mouse; GPI-HBP1 cDNA ORF Clone, Mouse

GPIHBP1 Background Information

Glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1 (GPIHBP1), an endothelial cell protein, binds LPL in the subendothelial spaces and transports it to the capillary lumen. GPIHBP1, a glycosylphosphatidylinositol (GPI)-anchored protein of capillary endothelial cells, transports lipoprotein lipase to the capillary lumen and is essential for the lipolytic processing of triglyceride-rich lipoproteins. GPIHBP1 was positively correlated with LPL, and GPIHBP1 is a better marker for body weight decrease than LPL.
Full Name
glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait