MCM5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

MCM5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2205 bp
Description
Full length Clone DNA of Mouse minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MCM5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

AA617332 cDNA ORF Clone, Mouse; AI324988 cDNA ORF Clone, Mouse; AL033333 cDNA ORF Clone, Mouse; Cdc46 cDNA ORF Clone, Mouse; Mcmd5 cDNA ORF Clone, Mouse; P1-CDC46 cDNA ORF Clone, Mouse

MCM5 Background Information

Full Name
minichromosome maintenance complex component 5
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait