Nectin-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

1/1
Price:
Size:
Number:

Nectin-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2322 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6C/T,9G/T,12C/A not causing the amino acid variation.
Description
Full length Clone DNA of Mus musculus poliovirus receptor-related 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI(three restriction sites) + NotI(6.54kb+0.42kb+0.37kb+1.54kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Nectin-2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Nectin-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Validated Images

Nectin-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AI325026 cDNA ORF Clone, Mouse; AI987993 cDNA ORF Clone, Mouse; Cd112 cDNA ORF Clone, Mouse; MPH cDNA ORF Clone, Mouse; nectin-2 cDNA ORF Clone, Mouse; Pvr cDNA ORF Clone, Mouse; Pvs cDNA ORF Clone, Mouse

Nectin-2 Background Information

Cluster of Differentiation 112 (CD112), also known as poliovirus receptor related protein 2 (PVRL2 or PRR2), is a single-pass type I transmembrane glycoprotein belonging to the Immunoglobulin superfamily. CD112 protein also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and thus is involved in cell to cell spreading of these viruses. CD112 protein has been identified as the ligand for DNAM-1 (CD226), and the interaction of CD226/CD112 protein can induce NK cell- and CD8+ T cell-mediated cytotoxicity and cytokine secretion. CD112 has been regarded as a critical component in allergic reactions, and accordingly may function as a novel target for anti-allergic therapy.
Full Name
poliovirus receptor-related 2 (herpesvirus entry mediator B)
References
  • Bachelet I, et al. (2006) Mast cell costimulation by CD226/CD112 (DNAM-1/Nectin-2): a novel interface in the allergic process. J Biol Chem. 281(37): 27190-6.
  • Wang L, et al. (2009) Molecular cloning, characterization and three-dimensional modeling of porcine nectin-2/CD112. Vet Immunol Immunopathol. 132(2-4): 257-63.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait